Steps in Quantitative RT-PCR



I.               Preparation of total RNA

 

Reagent  -  TRIzol Reagent (Cat# 15596-018) - Invitrogen

Have used for preparation of total RNA from a variety of mouse (adult brain, liver, spleen, kidney, testis, ovary, heart and lung; embryonic brain, liver, kidney, spleen; mouse embryonic fibroblasts) and human (cell culture, T cells) tissues

 

 

II.              Reverse transcription reaction

 

Kit  -  Superscript First Strand Synthesis for RT-PCR (Cat# 11904-018)- Invitrogen

 

Conditions

            Reverse transcribe 5 ug total RNA

primed with 200 ng random hexamers

 

Reaction mixture - 1X RT Buffer[20mM Tris-HCl, pH8.4, 50mM KCl], 2.5mM MgCl2, 10mM DTT, 500 uM each dNTP

 

Procedure

1.     Add 5 ug total RNA + 200 ng random hexamers, incubate (10min, 70C), chill on ice for 1 min

  1. Add reaction mixture, incubate (5 min, 25C)
  2. Add 50 Units Superscript RT, incubate [(10 min, 25C), (50 min, 42C), (15min, 70C)], chill on ice
  3. Add 2 units of RNase H, incubate [(20 min, 37C), (15 min, 70C)]

 

 

III.            QPCR

 

 Kit - SYBR Green PCR Core Reagent (Cat# 4304886) - Applied Biosystems

Accessory Reagents -


iCycler iQ 96 well PCR plates (Cat# 2239441) (for BioRad system)
iCycler iQ Optical tape (Cat# 2239444) (for BioRad system)
Fluorescein Calibration Dye (1mM in DMSO, Cat# 170-8780) (for BioRad system)


or

MicroAmp Optical 96 well Rxn Plate (Cat#N801-0560) - Applied Biosystems (for ABI system)

MicroAmp Optical Caps (Cat#N801-0935)  - Applied Biosystems (for ABI system)

 

We use the SYBR Green assay.  SYBR Green is a dye which binds indiscriminately to double-stranded DNA.  (The actual Taqman assay involves the use of a dye-labeled probe which binds to the intervening sequence between the two primers; its removal during amplification is responsible for a change in fluorescence.)  The advantage of the SYBR Green assay is that it does not require the use of the dye-labeled probe.  It does, however, require the amplicon to be a single, clean product.  The change in fluorescence required for real-time analysis is the result of SYBR Green binding to increasing amplified product. 

 

Reaction conditions:

 

            1X SYBR PCR Buffer

            3mM MgCl2

            200uM each dNTP

            0.5 Units AMP Erase UNG (for ABI system only) for Bio-Rad iCycler add 10nM fluorescein for internal standard.

            100 nM forward primer

            100 nM reverse primer

            1.25 Units AmpliTaq Gold polymerase

 

            25 uL reaction volume  (24 uL rxn mixture + 1 uL cDNA)

 

Primer design (characteristics):

 

            22mers

            50% G or C residues

            amplicon size between 100 - 150 bp

            cross intron-exon boundary

 

 

PCR conditions:

 

            50C-2min

            95C-10 min

 

            40 cycles of 95C-15sec, 60C-1 min

 

 

Four primary steps / considerations

 

1.     Establish working range within which your gene of interest falls.

 

We began by diluting our RT product for 5 points of analysis (1:10, 1:30, 1:100, 1:300, 1:1000) to allow us to generate a standard curve.  Assuming a 100% efficient RT reaction, the range over which this curve lies is from approximately 8 pg >  8 ng of cDNA. We dilute our unknown samples (for most genes) 1:10 or 1:100 which allows us to quantify using the above standard curve.

 

We try to use the same threshold value (0.100 for ABI or 100 for BioRad) for each analysis which allows us to maintain consistency in analysis from run to run. 

 

 

2.     Establish comparably efficient reactions between control gene and gene of interest.

 

We use beta-2-microglobulin  as our control gene for both mouse and human PCR.  Since the use of SYBR Green requires two separate reactions (gene of interest and control), we normalize our results to beta-2-microglobulin to to minimize sample-to-sample variability.  Other possible ubiquitously expressed control genes may include GAPDH, cyclophilin, 28S rRNA, etc.

 

It is important that the efficiency (determined by the slope of the curve generated) for your gene of interest and the control gene are similar.  This will allow you to use the delta Ct method of analysis in a particular run which is merely a subtraction of the Ct values for the 2 genes.  This saves you from having to run a standard curve in each reaction.   

 

 

3.     Analysis via a relative standard curve.

 

Use serial dilutions of the RT rxn, as described above, (ex. 1:30, 1:100, 1:300, 1:1000 etc.) to derive a relative value which can be used to compare WT vs. mutant or treatment type, or whatever you may want to directly compare.  Calculate the relative values of your unknowns vs. the relative standard curve.

 

 

4.     Analysis via an absolute standard curve.

 

Due to the lack of long-term stability (repeated freezing-thawing, etc.) of a particular RT product, the best, most reproducible standard curve can be derived from a (plasmid) DNA curve.  Prepare plasmids containing your amplified segment  Use a standard curve of known amounts of a specific plasmid (ex. 25 pg, 0.25 pg, 0.025pg, etc.) for both the control gene and the gene of interest.  An absolute standard curve would allow you to quantify your expression on the basis of cell number or other method.
Primers used in Gronostajski lab:

 

mb2mg        B2MM            AGACTGATACATACGCCTGCAG              119bp product

                  B2MMC            GCAGGTTCAAATGAATCTTCAG

 

mA total      mNFI-AE23      TGGCATACTTTGTACATGCAGC             128bp product

                  mNFI-AE4C2     ACCTGATGTGACAAAGCTGTCC

 

mB total      mNFI-BE2        GTTTTTGGCATACTACGTGCAGG           133bp product

                  mNFI-BE3C       CTCTGATACATTGAAGACTCCG

 

mC total      mNFI-CE22      GACCTGTACCTGGCCTACTTTG              147bp product

                  mNFI-CE4C       CACACCTGACGTGACAAAGCTC

 

mX total      mNFI-XE2        CTGGCTTACTTTGTCCACACTC              148bp product

                  mNFI-XE4C       CCAGCTCTGTCACATTCCAGAC



Biorad iCycler use:  To use the instrument properly you will need to read the appropriate parts of the manual and understand them.  Below is a short summary of steps.
  1. Turn on iCycler and camera.  Place the 96 well plate into the iCycler.
  2. Log onto the computer.
  3. Open "iCycler" program.
  4. In the Protocol Library Module, either select a previously stored Protocol or create a new Protocol.
  5. In the Protocol Library Module, either select a previously stored Plate Setup or create a new Plate Setup.
  6. Choose "View Protocol" tab and select "Run".
  7. On the "Run Prep" screen, change sample volume to 25ul and verify that the appropriate Thermal Protocol and Optical Plate Setup files are identified.
  8. Choose "Begin Run"
  9. When prompted, select apprpriate folder to store data file.  After selection the run should start.
  10. Upon completion of PCR (~3 hrs), perform data analysis.  You will need to read the manual to understand how to analyze the data.